A practical reference on epitalon: what it is, how it behaves, what the literature reports, and where the honest uncertainties sit.
Reviewed 2025-12-10. Anything still debated is marked as such rather than presented as settled.
The peptide is a synthetic analogue of epithalamin, a preparation extracted from bovine pineal glands. Investigators sought a short, chemically defined molecule that would reproduce some of the endocrine and gerontological observations attributed to the glandular extract. Proposed mechanisms centre on induction of telomerase activity, an effect reported in cultured human somatic cells in the early 2000s, together with influences on melatonin secretion and neuroendocrine regulation. Those mechanisms remain incompletely characterised, and the reported telomerase response has not been consistently reproduced by independent groups working in comparable systems.
Published work on this compound consists mainly of in vitro experiments, animal studies, and small clinical investigations, a substantial share of which appeared in Russian-language journals. Sample sizes are generally small, control conditions differ between studies, and several endpoints rely on markers whose clinical meaning is itself debated. Reviews of the longevity field treat the peptide as an early example of telomerase-directed research rather than an established intervention. Regulatory treatment varies by country: some jurisdictions place it under prescription controls, others treat it as a laboratory material, and importation may be restricted regardless of local status.
Published evidence comes mainly from Russian-language journals and from a single research group, with small sample sizes and limited independent replication. A few laboratories outside that group have examined related peptides and reported weaker or absent telomerase effects, so the central claim is best described as contested rather than settled. Rodent studies report modest changes in some ageing markers and in survival, but designs vary and control conditions are often sparse. No large randomised trial in humans has been published, and long-term safety data in healthy populations are correspondingly thin.
Epitalon is a synthetic tetrapeptide with the sequence alanine-glutamate-aspartate-glycine, commonly abbreviated AEDG. It was designed at the St. Petersburg Institute of Bioregulation and Gerontology as a short, chemically defined analogue of epithalamin, a fraction obtained from bovine pineal tissue. Small peptide bioregulators of this type formed a long-running line of work there from the 1980s onward. Because the molecule is produced by solid-phase synthesis rather than extraction, its composition is exact and its purity can be measured directly.
The most frequently cited proposed action is induction of telomerase, the enzyme that adds repeat sequences to chromosome ends. Cell-culture work from the originating group reported higher telomerase reverse transcriptase expression and measurable telomere elongation in human somatic cells after exposure. How a four-residue peptide would reach nuclear gene regulation is not established, and no cell-surface receptor or uptake route has been identified. Additional reports describe changes in melatonin secretion, antioxidant enzyme activity and lipid peroxidation in aged animals, but these findings remain mechanistically unconnected to the telomerase observation.
| Property | Value | Notes |
|---|---|---|
| Peptide sequence | Ala-Glu-Asp-Gly | Often abbreviated AEDG in research literature |
| Common synonyms | Epithalon, epitalon, AEDG | Spelling variants refer to the same tetrapeptide |
| Molecular formula | C14H22N4O9 | Theoretical monoisotopic mass near 390.35 Da |
| Appearance | White to off-white powder | Typically supplied as a lyophilised solid |
| Solubility class | Freely soluble in water | Hydrophilic peptide; dissolves in aqueous buffer |
The proposed relationship between epitalon and pineal function is a central part of its background. Khavinson's group reported that short peptides corresponding to regions of larger pineal proteins could influence gene expression in cells. Epitalon was framed as a synthetic analogue of an active fragment rather than a direct isolation product. Whether the tetrapeptide reproduces the effects of the parent extract is an open question, because comparative studies are limited and the parent extract itself is not a single defined substance.
Interest in epitalon is usually discussed within the broader field of short peptide bioregulators, a category that includes other synthetic di-, tri-, and tetrapeptides studied by the same research group. These compounds share a common rationale: that small fragments of tissue-derived proteins can retain biological activity and can be produced reproducibly. The category as a whole remains outside mainstream pharmacological consensus, and epitalon specifically has a limited presence in independent, non-Russian research literature, which shapes how its evidence base is described.
In its supplied form epitalon is a white to off-white powder, usually lyophilized and often hygroscopic. It dissolves readily in water and in aqueous buffers, and it is commonly handled as the acetate or trifluoroacetate salt to improve stability during purification and drying. The amide backbone is labile in aqueous media, so solutions are less durable than the dry solid. Handling notes in the chemical literature therefore emphasize keeping the powder dry, cool and shielded from light until it is dissolved.
Epitalon is a synthetic tetrapeptide whose sequence is alanine-glutamate-aspartate-glycine, written in single-letter code as AEDG. The four residues are joined by three peptide bonds, giving a linear backbone with no branching and no disulfide bridges. Its calculated molecular mass for the free form is approximately 390.3 daltons, a figure that rises when the compound is supplied as an acetate or trifluoroacetate salt. Because the chain is short, the molecule is defined entirely by its residue order rather than by any folded three-dimensional structure.
== Formation and morphology == During embryonic development, the anterior and posterior pituitary merge due to regulated cell-to-cell interactions, signaling pathways, and numerous transcription factors. Of the pituitary endocrine cells, the gonadotropic cells are the last to form and become functional. It has been found through studies with zebrafish that glycoprotein 𝞪-subunit (gpa) and thyroid-stimulating hormone beta (tshb) expressing cells are precursors for gonadotropes and thyrotropes. Even further, the genes involved in the final differentiation of these precursors into gonadotropes are sine oculus 1 (six1), eyes absent homolog 1 (eya1), steroidogenic factor 1 (sf1), and paired-like homeodomain 1 (pitx1).
Battle for the Mariana Islands on YouTube Order of battle WW2DB: The Marianas and the Great Turkey Shoot Battle of the Philippine Sea at Combinedfleet.com Animated History of The Battle of the Philippine Sea The Controversy over Spruance's Decision Air Group 31's participation in the Battle of the Philippine Sea A Brief Account of the Battle
== Career and writing == After leaving Oxford, Halliwell briefly lectured at the Portsmouth Polytechnic (1973–74). He took up a position as lecturer at King's College London in 1974, remaining there until 2000, rising to the position of Professor of Medical Biochemistry in the Division of Pharmacology. He also simultaneously held a visiting professorship at the University of California, Davis, United States (1995–99). After a 1998 sabbatical at the National University of Singapore (NUS), he moved there in 2000 as chair of the biochemistry department. As of 2018 he is a professor in the department of biochemistry at the NUS Yong Loo Lin School of Medicine. Halliwell is currently the Senior Advisor, Academic Appointments and Research Excellence, Office of the Provost, at the National University of Singapore (NUS). He is also Chairman of the Biomedical Research Advisory Council (BMAC), Agency for Science, Technology & Research (A*STAR). Halliwell served as the NUS's first Deputy President (Research and Technology) in 2006–15, founding the Graduate School for Integrative Sciences and Engineering, and overseeing a more than doubling in the university's research grants and the creation at NUS of Singapore's first Research Centre of Excellence (RCEs). He was subsequently appointed Senior Advisor to the NUS President. His textbook, Free Radicals in Biology and Medicine, co-written with John M. C. Gutteridge, is considered "an authoritative text in the field".
In pre-life, a 31 nucleotide D loop minihelix (GCGGCGGUAGCCUAGCCUAGCCUACCGCCGC) was ligated to two 31 nucleotide anticodon loop minihelices (GCGGCGGCCGGGCU/???AACCCGGCCGCCGC; / indicates a U-turn conformation in the RNA backbone; ? indicates unknown base identity) to form the 93 nucleotide tRNA precursor. To generate type II tRNAs, a single internal 9 nucleotide deletion occurred within ligated acceptor stems (CCGCCGCGCGGCGG goes to GGCGG). To generate type I tRNAs, an additional, related 9 nucleotide deletion occurred within ligated acceptor stems within the variable loop region (CCGCCGCGCGGCGG goes to CCGCC). These two 9 nucleotide deletions are identical on complementary RNA strands. tRNAomes (all of the tRNAs of an organism) were generated by duplication and mutation. Very clearly, life evolved from a polymer world that included RNA repeats and RNA inverted repeats (stem-loop-stems). Of particular importance were the 7 nucleotide U-turn loops (CU/???AA). After LUCA (the last universal common (cellular) ancestor), the T loop evolved to interact with the D loop at the tRNA "elbow" (T loop: UU/CAAAU, after LUCA). Polymer world progressed to minihelix world to tRNA world, which has endured for ~4 billion years. Analysis of tRNA sequences reveals a major successful pathway in evolution of life on Earth.
=== Aftermath === An informal memorial was held for Staley on the night of April 20, 2002, at the Seattle Center, which was attended by at least 100 fans and friends, including Alice in Chains bandmates Cantrell, Starr, Inez and Kinney, and Soundgarden frontman Chris Cornell. Staley's body was cremated and a private memorial service was held for him on April 28, 2002 at Kiana Lodge in Poulsbo, Washington. During her appearance on Celebrity Rehab in 2010, Staley's mother said she has kept his ashes in a box. Staley's private memorial was attended by his family and friends, along with his Alice in Chains bandmates, the band's manager Susan Silver and her then-husband Chris Cornell, as well as other music personalities. Chris Cornell, joined by Heart's Ann and Nancy Wilson, sang a rendition of The Rolling Stones' "Wild Horses" at the funeral. They also performed The Lovemongers' song "Sand". Jerry Cantrell dedicated his solo album, Degradation Trip, released two months after Staley's death, to his memory. Cantrell also took in Staley's cat, Sadie, who he and the family took care of until Sadie's death in 2010, at the age of 18. Shortly after Staley's death, his parents Nancy McCallum and Phil Staley started receiving donations from fans all over the world. Nancy and Phil worked with Seattle's Therapeutic Health Services clinic to create the Layne Staley Memorial Fund to help other heroin addicts and their families in the Seattle music community. Alice in Chains remained inactive following Staley's death.
Sources: en.wikipedia.org
== Use in humidity control == There is net evaporation from a solution with a water activity greater than the relative humidity of its surroundings. There is net absorption of water by a solution with a water activity less than the relative humidity of its surroundings. Therefore, in an enclosed space, an aqueous solution can be used to regulate humidity.
Lilly turned over operation of the family business to his son, Josiah, who ran the company for the next several decades. Col. Lilly remained active in civic affairs and assisted a number of local organizations, including the Commercial Club of Indianapolis, which later became the Indianapolis Chamber of Commerce, and the Charity Organization Society, a forerunner to the Family Services Association of Central Indiana, an organization supported by United Way of America. Josiah's sons, Eli and Joe, were also philanthropists who supported numerous cultural and educational organizations.
=== Preregistration === Coacillium (LH-8) – topical, other routes – alopecia areata, alopecia – various mechanisms of action Gecaxitinib (gecacitinib, jaktinib) – oral – alopecia areata – ACVR1 protein inhibitor, Janus kinase 1 inhibitor, Janus kinase 2 inhibitor, Janus kinase 3 inhibitor, TYK2 kinase inhibitor Ivarmacitinib (ARQ-252, ARQ-255, SHR-0302) – oral – alopecia areata – Janus kinase 1 inhibitor
Baptized Sikhs are specifically instructed to have unshorn Kesh (the hair on their head and beards for men) as a major tenet of the Sikh faith. To Sikhs, the maintenance and management of long hair is a manifestation of one's piety. The majority of Muslims believe that adult removal of pubic and axillary hair, as a hygienic measure, is religiously beneficial. Under Muslim law (Sharia), it is recommended to keep the beard. A Muslim may trim or cut hair on the head. In the 9th century, the use of chemical depilatories for women was introduced by Ziryab in Al-Andalus.
Sources: en.wikipedia.org
High-vacuum systems generally require metal chambers with metal gasket seals such as Klein flanges or ISO flanges, rather than the rubber gaskets more common in low vacuum chamber seals. The system must be clean and free of organic matter to minimize outgassing. All materials, solid or liquid, have a small vapour pressure, and their outgassing becomes important when the vacuum pressure falls below this vapour pressure. As a result, many materials that work well in low vacuums, such as epoxy, will become a source of outgassing at higher vacuums. With these standard precautions, vacuums of 1 mPa are easily achieved with an assortment of molecular pumps. With careful design and operation, 1 μPa is possible. Several types of pumps may be used in sequence or in parallel. In a typical pumpdown sequence, a positive displacement pump would be used to remove most of the gas from a chamber, starting from atmosphere (760 Torr, 101 kPa) to 25 Torr (3 kPa). Then a sorption pump would be used to bring the pressure down to 10−4 Torr (10 mPa). A cryopump or turbomolecular pump would be used to bring the pressure further down to 10−8 Torr (1 μPa). An additional ion pump can be started below 10−6 Torr to remove gases which are not adequately handled by a cryopump or turbo pump, such as helium or hydrogen. Ultra-high vacuum generally requires custom-built equipment, strict operational procedures, and a fair amount of trial-and-error. Ultra-high vacuum systems are usually made of stainless steel with metal-gasketed vacuum flanges.
1944 - Li was the first person to isolate growth hormone from cow brains. The lack of function of cow growth hormone on human body motivated Dr. Li to find human growth hormone. 1956 - Li successfully isolated human and monkey growth hormone and demonstrated its efficacy to treat hypopituitary children. 1969 - Li discovered the complete primary structure of sheep prolactin. 1970 - Li synthesized proteins with human growth hormone activity.
== External links == Somatotropin+receptors at the U.S. National Library of Medicine Medical Subject Headings (MeSH) Illustration at nih.gov Overview Growth Hormone Receptor Archived 2015-10-16 at the Wayback Machine: Molecule of the Month by Shuchismita Dutta and David Goodsell (April 2004) PDBe-KB provides an overview of all the structure information available in the PDB for Human Growth hormone receptor
=== Judiciary === Kennedy is a member of the Senate Judiciary Committee. As a member, he voted to confirm Justices Neil Gorsuch, Brett Kavanaugh, and Amy Coney Barrett. He voted against the nomination of Justice Ketanji Brown Jackson. Kennedy has defended the blue slip process for district court judges, saying that it "encourages bipartisan cooperation … The blue slip process makes our court system fairer and stronger. And that’s good for our democracy." He often asks judicial nominees basic questions about the Constitution during their confirmation process, occasionally stumping them. Kennedy has opposed the effort to add more justices to the Supreme Court, claiming it would "delegitimize" the Court. He has said he supports judges and justices who believe in "judicial restraint", adding, "Federal judges don't make law. They don't tell us what the law ought to be. They tell us what the law is." Kennedy opposed Congress establishing ethics standards for justices. He claimed such a move would violate the Constitution and called it "a crusade to undermine the United States' Supreme Court's legitimacy and the credibility of the federal judiciary." Kennedy's sharp questioning in the Judiciary Committee led to the eventual firing of former Department of Homeland Security Secretary Kristi Noem after he asked her why she had spent hundreds of millions of dollars on advertisements in which she prominently featured herself. Kennedy said he had spoken to President Trump about Noem's spending and that Trump was "mad as a mama wasp" when Noem claimed Trump had approved the spending.
The EPRDF capitalized on the mismanaged PDRE's weakening state and general unpopularity when rebel forces officially seized power from the PRDE in May 1991. Soon after the EPRDF secured the nation's capital, a "National Conference on Peace and Reconciliation" was called in Addis Ababa. Held in July 1991, the conference was intended to outline a transitional framework for the period following the newest regime change. Some notable ethnicity-based political movements that were present include the Oromo Liberation Front, the Afar Liberation Front, and the Western Somali Liberation Front. Any political organizations that wanted to attend was required to be centered around ethnic identity; thus, several organizations were quickly created for that purpose, resulting in the rapid development of urban elite-led ethnicity-based movements. Any person or political organization that had been associated with Mengistu Haile Mariam's Workers' Party of Ethiopia was also not permitted to attend.
Sources: en.wikipedia.org
Epitalon is a synthetic four-amino-acid peptide with the sequence alanine–glutamate–aspartate–glycine, also written AEDG. It was developed in Russian gerontology research and is studied for proposed effects on telomerase, melatonin regulation, and neuroendocrine function. It is not an approved pharmaceutical in the United States or the European Union.
No. Epithalamin is a peptide-rich extract prepared from bovine pineal glands, while epitalon is a short synthetic peptide designed as a defined analogue of it. The synthetic version was intended to provide a reproducible molecule with some of the same proposed biological activity.
Telomere elongation and telomerase activation have been reported in cultured human somatic cells, but evidence from living human subjects is limited and has not been independently confirmed at scale. Reported findings come largely from small studies with differing designs, so the question remains open rather than settled.
No. Epithalamin is a peptide-containing extract of bovine pineal glands, while epitalon is a single synthetic tetrapeptide. The extract contains many peptides and other tissue components, so its composition varies between batches in ways that a synthesised sequence does not.